Plant Cell Rep (2007) 26:683–692 DOI 10.1007/s00299-006-0272-9 PHYSIOLOGY AND BIOCHEMISTRY Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α 2 gene that is essential for expression Hye-Min Lim · Jung-Il Cho · Sichul Lee · Man-Ho Cho · Seong Hee Bhoo · Gynheung An · Tae-Ryong Hahn · Jong-Seong Jeon Received: 13 September 2006 / Revised: 8 November 2006 / Accepted: 16 November 2006 / Published online: 5 January 2007 C  Springer-Verlag 2006 Abstract Arabidopsis harbors two α and two β genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPα genes were analyzed using transgenic plants containing a promoter::ß-glucuronidase (GUS) fusion construct. Whereas the AtPFPα1 promoter was found to be ubiquitously active in all tissues, the AtPFPα2 promoter is preferentially ex- pressed in specific heterotrophic regions of the Arabidop- sis plant such as the trichomes of leaves, cotyledon veins, Communicated by W. T. Kim H.-M. Lim · J.-I. Cho · M.-H. Cho · S. H. Bhoo · T.-R. Hahn · J.-S. Jeon () Plant Metabolism Research Center & Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701 Korea e-mail: jjeon@khu.ac.kr H.-M. Lim e-mail: supia1125@khu.ac.kr J.-I. Cho e-mail: birdlife@khu.ac.kr M.-H. Cho e-mail: manhocho@khu.ac.kr S. H. Bhoo e-mail: shbhoo@khu.ac.ur T.-R. Hahn e-mail: trhahn@khu.ac.kr S. Lee · G. An Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang, 790-784 Korea S. Lee e-mail: sciron @postech.ac.kr G. An e-mail: genean@postech.ac.kr roots, and the stamen and gynoecium of the flowers. Se- rial deletion analysis of the AtPFPα2 promoter identified a key regulatory element from nucleotides − 194 to − 175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPα2 and which is essential for AtPFPα2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a − 46 CaMV35S minimal promoter, we also demonstrate that PFPα2 is sufficient for normal AtPFPα2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPα2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes. Keywords GUS . PFPα2 . Promoter . Pyrophosphate:fructose-6-phosphate 1-phosphotransferase . Trichome Introduction During primary carbohydrate metabolism in the cytosol, the conversion between fructose-6-phospahte (Fru-6-P) and fructose-1,6-bisphosphate (Fru-1,6-bisP) is a rate-limiting step in both glycolysis and gluconeogenesis. This reaction is catalyzed by two mechanisms in many higher plants (Carlisle et al. 1990; Nielsen et al. 2004; Nielsen and Stitt 2001; Todd et al. 1995). One of these mechanisms is regulated by two enzymes, an ATP-dependent phos- phofructokinase (PFK) that catalyzes the glycolytic con- version of Fru-6-P to Fru-1,6-bisP, and cytosolic fructose- 1,6-bisphosphatase (FBPase) that catalyzes the reverse gluconeogenic reaction. In the alternative pathway, a bidirectional enzyme, pyrophosphate:fructose-6-phosphate Springer