Hypoplasia/aplasia of pelvis, femora, fibulae, ulna, digits and nails: Fuhrmann syndrome without WNT7A mutations Katta Mohan Girisha a , Thanvanthri Gururajan Vasudevan b , Abdul Vahab Saadi b , Hitesh Shah c , Puthiya Mundyat Gopinath b and Kapaettu Satyamoorthy b Clinical Dysmorphology 2011, 20:205–209 a Genetics Clinic, Department of Pediatrics, Kasturba Medical College and Hospital, b Manipal Life Sciences Center, and c Department of Orthopedics, Kasturba Medical College, Manipal University, Manipal, India Correspondence to Dr Katta Mohan Girisha, MD, DM, Consultant Geneticist and Associate Professor, Genetics Clinic, Department of Pediatrics, Kasturba Medical College and Hospital, Manipal University, Manipal-576104, India Tel: + 91 820 2923149; fax: + 91 820 2571934; e-mail: girishkatta@gmail.com; girish.katta@manipal.edu Received 3 May 2010 Accepted 16 May 2011 List of key features Hypoplastic phalanges Absent nails Hypoplastic nails Oligodactyly Hypoplastic pelvis Bowed femur Short femur Absent or hypoplastic fibula Hypoplastic ulna Introduction Development of limbs involves a complex interaction of various molecules that coordinates a three-dimensional signalling system (Niswander, 2003). The development of proximodistal axis is mainly under the control of fibroblast growth factors from the apical ectodermal ridge, anteroposterior from the sonic hedgehog from the zone of polarizing activity, and the dorsoventral axis by the bone morphogenetic proteins and engrailed from the ventral ectoderm and by WNT7A from the dorsal ectoderm. Limb/pelvis-hypoplasia/aplasia syndrome is a rare autosomal recessive condition with multiple defects of limbs. There are several cases described with over- lapping phenotypes notably, Fuhrmann syndrome (OMIM: 228930), Al-Awadi/Raas-Rothschild (AA/RR) syndrome (OMIM: 276820) and Schinzel phocomelia syndrome. Recently, mutations in WNT7A gene (OMIM: 601570) have been shown to cause these defects (Woods et al., 2006). We, herein, report a boy who had features of this condition; however, no mutation was identified in the WNT7A gene. Case report An 8-month-old male child was ascertained with multiple congenital anomalies. He was the first child born to a non- consanguineous healthy couple at full-term gestation with a birth weight of 1.75 kg (less than third centile). His mother had Chikungunya fever with arthralgia and fever at 3–4 months of pregnancy. She took nonsteroidal anti- inflammatory drugs for pain, and arthralgia continued beyond delivery. The child’s developmental milestones were normal; he attained head control by the age of 3 months, rolled over by the age of 4–5 months and crawled by the age of 6–7 months. He had social smile by the age of 3 months and had developed stranger anxiety recently. At 8 months of age he weighed 6.46 kg (nearly fifth cen- tile). His head circumference was 39 cm ( – 4 standard devi- ation) and length 55 cm (less than third centile). Long eyelashes and prominent eyebrows were noted (Fig. 1a). He had wide set eyes, mild upslant of palpebral fissures, broad nasal bridge, pointed chin with a groove in the submental region, long philtrum, prominent mouth and malformed ears (Fig. 1b). He had micromelia of all four limbs (Fig. 1c). Both hands showed clinodactyly and absence of nails in all fingers except the fifth fingers (Fig. 2). The right foot had three toes with hypoplastic nails (Fig. 3). The third digit was syndactylous. On the left side, there were short and bulbous toes. Skin dimples were noted on the dorsum of hands, knees and feet. He had normal male external genitalia. Radiographs showed hypoplastic pelvic wings, short and severe bending of femora into a ‘V’ shape, short humeri and absent fibulae (Fig. 4a). On the right foot, the fourth metatarsal was short and fourth and fifth proximal pha- langes were fused. The ulna was hypoplastic on both sides (Fig. 4b). Spine and ribs were normal. Ultrasonographic examination of abdomen, echocardiogram, blood counts, urine examination and renal functions were normal. On the basis of the above features, a diagnosis of limb/pelvis- hypoplasia/aplasia was made. Molecular methods Genomic DNA was extracted from peripheral lympho- cytes of the child and mother. The WNT7A gene was sequenced by individual amplification of the four exons using PCR followed by direct sequencing. The PCR reactions were carried out by using four sets of primers for each of the exons of the gene as given below (all 5 0 –3 0 ): exon 1(F) – CAGCAGCTAGCCCTCCC CCA and exon 1(R) – CGCGTCTCGCACACTTGCAC; exon 2(F) – GGGCACCTGAGGGTATTCTGGTGTand Short case report 205 0962-8827  c 2011 Wolters Kluwer Health | Lippincott Williams & Wilkins DOI: 10.1097/MCD.0b013e328348d956 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.