Indian Agricultural Research Institute, New Delhi, India Complete Genome Sequence, Phylogenetic Relationships and Molecular Diagnosis of an Indian Isolate of Potato Virus X Bikash ikash Mandal andal,Alok lok Kumar umar,Pooja ooja Rani ani and Rakesh akesh Kumar umar Jain ain AuthorsÕ address: Advanced Centre for Plant Virology, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi 110012, India (correspondence to B. Mandal. E-mail: leafcurl@rediffmail.com) Received May 20, 2011; accepted August 13, 2011 Keywords: Potato virus X, Indian isolate, complete genome, bacterial-expressed recombinant coat protein, ELISA, RT-PCR Abstract The complete genome of a Potato virus X (PVX) iso- late from India (ptDel-9), which occurred symptom- lessly in potato but induced ringspots on Nicotiana tabacum cv. Xanthi and necrotic mosaic on Nicotiana benthamiana, was sequenced. The genome was 6435 nucleotides long (JF430080) and contained five open reading frames. The isolate was closely related to those reported from the Eurasian region (95.1–97.1% sequence similarity) and distantly related to those reported from South America (77.2–77.9%). The CP gene was expressed in Escherichia coli as a 76-kDa fusion protein with maltose-binding protein and used to generate polyclonal antibodies, which successfully detected PVX in field samples of potato by ELISA. In 20% of field samples, for which ELISA failed, the virus was successfully detected by RT-PCR. This is the first report of molecular characterization of PVX occurring in India. Introduction Potato virus X (PVX), the most widespread of potato viruses, infects several solanaceous crops including potato, tomato and tobacco and also infects experi- mental species of the Chenopodiaceae, Amaranthaceae and Fabaceae. It is usually transmitted by contact of infected with healthy plants. PVX, the type member of the genus Potexvirus, family Flexiviridae, has flexuous filamentous virions measuring 470–580 nm, which con- tain a +ss RNA (5.9–7.0 kb) genome (Fauquet et al. 2005). Potato virus X was first recorded in India by Vasud- eva and La1 (1944). PVX alone induces mild symp- toms in potato but severe stunting in plants co-infected with Potato virus Y (PVY) (Rochow and Ross 1955; Khurana Paul and Singh 1988). A yield loss up to 30% was recorded in potato due to PVX alone, and mixed infection with PVY dramatically decreased yield (Khurana and Singh 1988). In India, PVX was previously characterized by its biological properties, transmission, host range and yield loss, but not by molecular properties. As genomic properties are important for developing tools for diagnosis and man- agement, we report here the complete genome charac- terization, phylogenetic analysis and molecular diagnosis of PVX from India. Materials and Methods Virus source and sap transmission Symptomless potato leaf samples were collected from the experimental field of the Indian Agricultural Research Institute (IARI), New Delhi, in January 2009, and PVX was identified by DAC-ELISA (Clark and Bar-Joseph 1984) using polyclonal antibodies (PAbs) (Bioreba, Reinach, Switzerland) and electron microscopy. Initially, the virus isolate (ptDel-9) was mechanically transmitted to Gomphrena globosa, an assay host, and subsequently maintained on Nicotiana benthamiana. Host reactions were determined by sap inoculation of ten seedlings of each species at 3- to 5- leaf stage. Cloning and sequencing of complete genome RNA was extracted from infected N. benthamiana leaf tissues using RNeasy Plant Mini kit (Qiagen, Chats- worth, CA, USA). The complete genome sequence of PVX RNA was generated with two amplified fragments using two pairs of primers, BM86F ( gtcgacgaaa- actaaaccatacacca) and BM87R ( gtcgacgaaaactaaa- ccatacacca), and BM88F ( gtcgacgatactcgaaagatgtcagc) and BM89R ( gtcgacatttatattattcatacaacaaac) based on the sequence information of other PVX isolates avail- able in the database (Table 1). The amplicons were cloned in the T&A cloning vector (Real Biotech Cor- poration, Banqiao, Taiwan), and two clones were sequenced. The sequences of cloned fragments were assembled using BioEdit (http://bioedit. software.informer. com), and phylogenetic analysis was conducted in mega mega J Phytopathol 160:1–5 (2012) doi: 10.1111/j.1439-0434.2011.01848.x Ó 2011 Blackwell Verlag GmbH