Biosystems) and an ABI377 (Applied Biosystems) sequencer. The sequence data were analysed with Sequencher software. Polymorphisms: Seven putative SNPs were discovered by com- parisons of the sequences of the 1757 bp obtained from the 92 unrelated pigs. The position of the polymorphic nucleotides and the allele frequencies are summarized in Table 2. Chromosomal location: The porcine gene INSL3 was mapped to chromosome 2q12-q13 by Rettenberger et al. 2 . References 1 Zimermann, S. et al. (1999) Mol Endocrinol 13 (5), 681±91. 2 Rettenberger, G. et al. (1994) Mamm Genome 5, 307±9. Correspondence: Yanzhang Gong (e-mail: gong7546@public.wh.hb.cn) Cloning of the canine delta tubulin cDNA (TUBD) and mapping to CFA9 D. J. Sidjanin*, B. Zangerl*, J. L. Johnson*, F. Xue*, C. Mellersh ² , E. A. Ostrander ² , G. Acland* and G. D. Aguirre* *James A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA.   Fred Hutchinson Cancer Research Center, Seattle, WA, USA Accepted 3 November 2001 Source/description: A canine retinal cDNA library (Stratagene, La Jolla, CA, USA) was polymerase chain reaction (PCR) screened with primers DT-3 and DT-12 designed based on the sequence from the human delta tubulin gene (TUBD, GenBank accession no. NM_016261). The obtained PCR product was sequenced and analysed using DNASTAR software package (DNASTAR Inc., Madison, WI, USA) to con®rm authenticity of the canine TUBD sequence. The 5¢ and 3¢ regions of the gene were generated using SMART-RACE cDNA Ampli®cation Kit (Clontech, Palo Alto, CA, USA); for the 5¢RACE we used primer DT-7 and for the 3¢RACE we used primer DT-5. The full length cDNA was assembled using DNASTAR software, and the sequence was deposited to the GenBank (accession no. AF416724). Comparison of the open reading frame (ORF) of the canine delta tubulin cDNA with human and mouse (GenBenk no. NM_016261 and NM_019756) shows 91 and 83.9% sequence identity between dog and human and dog and mouse, respectively. To generate a canine speci®c delta tubulin sequence-tagged site (STS) suitable for radiation hybrid (RH) mapping, primers DT-6 and DT-15 were used to amplify a product from canine genomic DNA. The obtained PCR product was sequenced and compared with the canine cDNA (GenBank accession no. AF416724) in order to identify putative intron/ exon boundaries. Primers DT-13 and DT-14 were designed from the putative intron and used for RH mapping. Primers: DT-3 5¢-GTGGAGAAATGTGACTCTTTCAGTGG-3¢ DT-5 5¢- CTCCTCAAACATCTGAGACA-3¢ DT-6 5¢-CCAGCTCTCTATACT TCTTG-3¢ Table 2 Single nucleotide polymorphisms (SNPs) in porcine INSL3. No. Type Context 1 Location 2 Allele frequency Remarks 1 G¬®T GCTCCTATAAKGGGGATCCCC 937 G0.73/T0.27 Promoter 2 G¬®C TGCTGGGCCCSGCCCTGGCAC 1016 G0.54/C0.46 Exon1 3 T¬®A GACTTTAAAAWACTGCCTTAA 1420 T0.87/A0.13 Intron 4 G¬®A CTTGCTTATTRAGGTTTGTTT 1453 G0.89/A0.11 Intron 5 C¬®A TCTCCTCATCMTAGTCCAGGT 1523 C0.78/A0.22 Intron 6 G¬®C TGCAGAGGCASATTTGGCAGG 1643 G0.95/C0.05 Intron 7 G¬®T¬®C CACGGCTGGGBACTTGGGTGT 1827 G0.76/T0.13/C0.11 Intron 1 The letters used for denoting SNPs: B  (G or T or C), K  (G or T), M  (C or A), R  (G or A), S  (G or C), and W  (T or A). 2 The location of SNPs in the sequence X73636. Table 1 PCR primers and the conditions for ampli®cation. Symbol Primers (Forward/Reverse) Annealing temperature Mg 2+ (mM) Products (bp) Frag-1 CACAGTCAAAGCTTGTCAGCAC/ ATTTGTAAGACTGCCTCGCTCC 62° C 2.5 574 Frag-2 TCACCTGGGCTCTAGTGCTGCT/ ACACCCTCATACCTCCTCCCAGT 62° C 3.0 697 Frag-3 ATTATGCGGTGGAGATCAGTGC/ CATCAGCCCATGGAAGAGATGT 60° C 2.5 600 Frag-4 GAACTGCTACAGTGGCTGGAAGG/ GGGTGTCATGAAATGCAGGGAG 60° C 2.5 513 161 Brief notes Ó 2002 International Society for Animal Genetics, Animal Genetics, 33, 158±167