DOI: https://doi.org/10.53350/pjmhs211551408 ORIGINAL ARTICLE 1408 P J M H S Vol. 15, NO. 5, MAY 2021 The effect of antifungal and Ago and Zno nanoparticles on Trichophyton mentagrophytes HIBA YOUNIS KHALAF 1* , HALA ABDULKHALIQ AWADH 2 , HADEEL MIZHER YOUNIS 3 , NAWAR ALI JASIM 4 , AND KASIM SAKRAN ABASS 5 1 Department of Microbiology, College of Veterinary Medicine, University of Tikrit, Tikrit, Iraq 2 Department of Biology, College of Science, University of Tikrit, Tikrit, Iraq 3 Department of Basic Sciences, College of Dentistry, University of Tikrit, Tikrit, Iraq 4 Department of Pathology, College of Veterinary Medicine, University of Tikrit, Tikrit, Iraq 5 Department of Anatomy and Histology, College of Veterinary Medicine, University of Kirkuk, Kirkuk, Iraq *Corresponding authors: email: hibamicrobiology@tu.edu.iq ABSTRACT This study aimed to determine the main species of dermatophytes which caused skin infection and effect of antifungal and Ago and Zno nanoparticles on them. The result of this study showed that out of 80 sample, 54 sample were positive to fungal isolation with ratio 67.5%. and according to culture and PCR results 8383 % of isolated type belong to Trichophyton mentagrophytes. Trichophyton mentagrophytes resistant to Nystatin and Fluconazole while sensitive to Griesofulvin, Clotrimazole and Flucytosin. MIC of Ago and Zno nanoparticle against Trichophyton mentagrophytes were 250 and 275 μg /ml while MFC were 275 and 300 μg /ml respectively. Results of RAPD PCR showed that both Ago and Zno nanoparticle effect in genetic material of Trichophyton mentagrophytes Key words: Trichophyton mentagrophytes, nanoparticle, RAPD PCR INTRODUCTION Skin is first line define against infection, it protects the body from external physical, chemical and biological effects, as well as it has physiological functions such as balancing the body temperature, its complex system formed about 15% from total body weight (1). Dermatophytes belong to deuteromycota fungi, it consist from three genus which are: Microsporum, Trichophyton and Epidermophyton. Its classified according to sources of infection in to: Anthropophilic species, Zoophilic species and Geophilic species (2). Dermatophytosis is most common types of skin infection, these group of fungi called keratophilic, it have Keratinase which help them in use of keratin as source of protein (3). Clinical of Dermatophytes infection can be classified according anatomical location of infection in: Tinea capitis, Tinea ungium, Tinea corporis, Tinea manum, Tinea barbae, Tinea pedis, Tinea faieci and Tinea cruris (4). Similarities between fungi cell and host cell and development of fungi resistant against antifungal drugs lead to difficulty in treatment of mycotic infection (5). Nanoparticles is one alternatives treatment to antifungal, which is a particles in size 10-100 nanometer, Manufactured by Down-Up Fabbrication or Up- Down Fabbrication, have different physical and chemical properties in compare with its origin, act as antifungal and a microbial agents (6). MATERIAL AND METHODS Sample collection and fungal diagnosis: (80) pathological skin samples were collected from outpatient clinics Under the supervision of dermatologists. The samples direct cultivation in Sabouraud dextrose agar and incubated at 25-30 ° C for 7days. After colony development, one colony selected for phenotypic examination and Microscopic examination applied according to (7) and a group of biochemical tests were applied (Hair penetration test, Urease enzyme test and Protease production test) according to (8). PCR test for confirmation diagnosis of Trichophyton mentagrophytes A- DNA extraction : DNA was extracted according to (7). B- DNA amplification mixture: as in Table (1) C- Thermocycler program: as in table (2) according to (9) Table (1) Compounds used in preparation of Reaction Mixture Compounds used in preparation of Reaction Mixture Reference Amount Taq PCR Master Mix KIT (Qiagen, Germany) Which contain Taq DNA Polymerase (2.5 Unit), PCR Buffer with 3mM MgCL2, 200μMdNTP 3 25 Panderm_F(5’GAAGAAGATTGTCGTTTGCATCGTCTC3 7 Out product size 336bp 0.3 from 100pM Solution. Panderm_R(5’CTCGAGGTCAAAAGCACGCCAGAG3’ 0.3 from 100pM Solution. DNA Template Samples 3 DNA free water (Qiagen, Germany) 8 21.4 Total 50 - Antifungal sensitivity test: applied by disc methods against Nystatin , Griesofulvin , Fluconazole, Clotrimazole , Flucytosin and according to (10). - Minimum inhibitory concentration (MIC)and Minimum fungicidal concentration (MFC) of nanoparticles (Ago and Zno) : applied by tube methods according to (11). with final nanoparticles concentration ( 100,200, 225, 250, 275, 300, 325, 350 μg /ml). - Study effect of nanoparticles on genetic materials of Trichophyton mentagrophytes by RAPD PCR: