167 STUDIES ON THE BIOINFORMATICS ANALYSIS FOR THE PPV (PLUM POX VIRUS) MOLECULAR MARKERS Ligia ION, Adrian Constantin ASĂNICĂ University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd., District 1, Bucharest, Romania Corresponding author email: ionnagyligia@yahoo.fr Abstract The plum pox virus produces an extremely damaging disease in fruit stone species with major implications in fruit production but also in phytosanitary status of fruit plantation. The genome of the virus encodes a single large polyprotein, a precursor that determines the serological properties of PPV, namely CP (Coat protein). This poly protein is proteolytically catalyzed by 3 viral encoding proteases that can synthesize up to 10 functional proteins. The capsid protein binds to the carboxyl end of the polyprotein. The in vitro properties of the viral extract vary with the strain and the plants used for propagation. Establishing the best primers for the molecular detection of the Plum pox virus is an extremely important stage, so a bioinformatics analysis it’s necessary to identify potential sources of results misconduct (sources of contamination that can produce false positive results) is taken into account. The detection primers P1 5 ’ ACCGAGACCATCACCCTCCC 3 ’ and P2 – 5 ’ CAGACTACACCGTCGCCAGA 3 ’ , were tested for the ability to form the hairpin secondary structure, self-dimerization capability, heterodimerization capability, Tm mismatch through the OligoAnalyzer program from IDT Company. The results have shown that the proposed primers can be used in PCR reactions and the results are not influenced by the artefacts. Key words: pox virus, primers, markers, bioinformatics. INTRODUCTION Plum pox produces a highly damaging disease in stone fruit trees species with major implications in fruit production but also in phytosanitary status of fruit plantation. Important economic loss and significant reduction in productive areas stimulated breeding programs aimed at enhancing resistance to the pathogen in such countries as Greece (Karayiannis I1999), France (Audergon J-M 1994), Italy (Bassi D.,1995) Spain (Egea J,1999), and the Czech Republic (Polák J 1994). Development of molecular marker maps for segregating crosses is a significant accomplishment toward understanding the genetics of PPV resistance and developing markers that could potentially be useful in breeding programs. Four molecular genetics maps based on intraspecific crosses introducing PPV resistance from North American cultivars ‘Stark Early Orange’ and ‘Goldrich’ have been established to map a PPV resistance in apricot (Lambert P2007); (Sicard O.2007) On these maps, a major genomic region associated with PPV resistance was located on the Prunus G1 at a distance of 20–40 cm. In total, five SSR markers linked to the targeted resistance locus were identified in this region. Three of them have been already successfully tested for marker assisted selection (MAS) in a set of susceptible/resistant cultivars. The bioinformatics analysis of molecular markers used in either PPV detection or marker assisted selection is a very important step in the process of breeding program of genetically- engineered varieties. MATERIALS AND METHODS This paper deals are to searching in the public data bases for sequences similar to those of primers to identify potential sources of results vitiation (sources of contamination that can produce false positive results). Activity was performed for each pair of primers with the BLAST program. The results obtained in alignment for primer pair P1 5 'ACCGAGACCATCACCCTCCC 3' and P2 - 5 'CAGACTACACCTCGCCGCCAGA 3 are shown in Figure 1. The simple way of running Scientifc Papers. Series B, Horticulture. Vol. LXIII, No. 1, 2019 Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653