ANNA ONDREJKOVÁ, RICHARD FRANKA, RÓBERT ONDREJKA, ŠTEFAN ŠVRČEK, JUDIT SÜLI, ZDENEK BENÍŠEK, PAVOL ZUBRICKÝ * , VIERA BAJOVÁ, ANDREJ BUGARSKÝ AND HERVÉ BOURHY ** Department of Infectious and Parasitic Diseases, University of Veterinary Medicine, 041 81 Košice, Slovakia * State Veterinary Institute, 080 01 Prešov, Slovakia ** Institut Pasteur, Rabies Unit, 75724 Paris Cedex 15, France e?mail: ondrejkova@uvm.sk ! " # The study describes identification of a lyssavirus isolate originating from a bat ($ ) captured in Slovakia. The bat flew accidentally into a family house where it came into contact with a human. It was subsequently cap? tured, euthanised and examined. Rabies antigen was detected by direct fluorescent antibody test (FAT), mouse inoculation test (MIT) and reverse transcriptase polymerase chain reaction (RT?PCR). By means of the direct sequencing of the amplifi? cation product of the nested reverse transcriptase polymerase chain reaction (nRT?PCR) gene of bat strain classified as a genotype 5 – $% was identified. : bat, rabies, lyssaviruses, PCR. Rabies is the most important lyssavirus infec? tion. It is an acute lyssavirus disease of warm blooded animals transmissible also to man. It affects particularly the central nervous system and its outcome is inevitably fatal, practically in all cases. In the past few decades, other rabies?related lyssaviruses caused rabies?like dis? eases in a wide range of animals, particularly bats, but also in humans. The preferred vector species of rabies? related lyssaviruses are bats that constitute approxi? mately 24% of all known mammal species (1, 20). An important role in epizootiology of rabies and rabies? related lyssaviruses on the European continent is played by insectivorous bats. Since 1977 till 2000 more than 630 rabies cases in bats were diagnosed (11, 15). From the insectivorous bats, $ is the most important vector of lyssaviruses. Out of more than 30 species of insectivorous bats living in Europe, approx. 95% positive cases were recorded exactly in $ (14, 15). Haematophagous vampires are an important reservoir of rabies in South America. The role of frugivorous bats in the transmission of a new geno? type of lyssaviruses (Australian bat lyssavirus – ABL) has not yet been explained sufficiently. The virus was isolated from a bat, $ , which flew accidentally into a family house and came into contact with a human. A sample of the brain from this bat was sent to our laboratory by the State Veterinary Institute in Prešov (Slovak Republic). The rabies antigen was detected by the fluorescence antibody test (FAT) in brain impression smears. The material obtained was also subjected to an inoculation test ac? cording to Koprowski (10). The material was stored in a deep?freezer box at –70 o C. The PCR was performed according to the pro? cedure recommended by WHO (19), partially modified by our laboratory (8). Total RNA was extracted from brain samples (50?100 mg) using the TRIZOL method (Invitrogen) according to producer’s instructions. RNA was purified with chloroform, precipitated with isopro? panol (Merck) after washing with 75% ethanol, dried at room temperature in a laminar flow cabinet and dis? solved later in 50 Rl of nuclease?free water and stored at –20 o C. Reverse transcription of total RNA into cDNA was performed using an antisense N60 primer 5´? TCCATAATCAGCTGGTCTCG?3´. Unwinding of nucleic acids took place in a solution that contained 2 Rl of primer N60 (15 pmol/Rl) with 2 Rl of extracted RNA and 6 Rl of sterile water at 72 o C during 3 min. After cooling the reaction solution in crushed ice and per? forming the hybridisation of primer, 20 Rl of transcrip? tion mix containing 6 Rl of 5x reaction buffer, 5 Rl (2mM) of dNTP, 0.5 Rl (20 U) of RNAsin, 1 Rl (200 U) of reverse transcriptase, and 7.5 Rl of nuclease?free water was added to each sample. The reverse transcription took place in a total volume of 30 Rl for 50 min at 42 o C. In addition to a positive control also a negative sample (RNA from a negative brain) was subjected to the reaction. The syn?