DOI: https://doi.org/10.53350/pjmhs2115112893 ORIGINAL ARTICLE P J M H S Vol. 15, No.11, NOV 2021 2893 Unexpected Discovery of Hemoglobin D Iran Families in Punjab, Pakistan by using two different Screening Methods NADA SIKANDER 1 , SHABNAM BASHIR 2 , RIJA TARIQ 3 , FURQAN SABIR 4 , SAMIA AKHTAR 5 , AMNA TARIQ 6 1 Consultant Hematologist Punjab Thalassemia Prevention Project 2 Project Director, Punjab Thalassemia Prevention Project 3 Consultant Hematologist, Punjab Thalassemia Prevention Project 4 DNA Lab Consultant, Punjab Thalassemia Prevention Project 5,6 Lab technician, Punjab Thalassemia Prevention Project Corresponding author: Dr. Nada Sikander, E.mail:nadajsikandar@gmail.com ABSTRACT Background: Hemoglobin D Iran is frequently misdiagnosed as Hb E or Hb D Punjab if only one method of screening is used. The objective of our study was to highlight the importance of using two different screening techniques in diagnosis of a hemoglobin variant, Hb D Iran in our case. Hematological parameters of heterozygous Hb D Iran and compound heterozygous β/Hb D Iran were also compared. Methods: A descriptive study was carried out on results of 52,379 subjects which were part of thalassemia extended family cascade screening from 36 districts of Punjab from October 2019-March 2021. Cases of Hb D Punjab and Hb E were run on both CE-HPLC (cation exchange-high performance liquid chromatography) and CZE (capillary zone electrophoresis). Resulting Hb D Iran cases were confirmed by ARMS-PCR (Amplification refractory mutation system-polymerase chain reaction). Results: Forty cases of Hb D Iran were detected out of 160 initially suspected Hb D Punjab cases and 126 Hb E cases. Diagnosis was confirmed by molecular analysis. Statistical significance was found between RBC count, MCV, MCH, Hb F and diagnosis of “heterozygous Hb D Iran” and “compound heterozygous for β/ Hb D Iran”. Conclusion: Hb D Iran can be easily missed and misdiagnosed as Hb E or Hb D Punjab, if two screening methods are not used. This maybe a reason why Hb D Iran remains unreported in our region. CBC and HPLC indices can also be suggestive if a case is of heterozygous D Iran or compound heterozygous β/Hb D Iran. Keywords: Hb D Iran, Hb E, Hb D Punjab, Cation exchange High performance liquid chromatography, Capillary zone electrophoresis INTRODUCTION Hb D Iran is a rare hemoglobinopathy and remains largely unreported due to its asymptomatic phenotype and also because of it being misdiagnosed or missed. It is a clinically insignificant structural hemoglobin variant, arising as a consequence of point mutation in codon 22 of beta globin gene in which glutamine replaces glutamate (GAA>CAA, Glu >Gln). It was first identified in heterozygous form, both in an Iranian patient and in a Pakistani family in the United States 1 . This hemoglobin variant is common in Iran, however its prevalence in Pakistan is generally unknown. Two studies conducted in India revealed only 1 out of 2600 patients with suspected Hb variant as a case of Hb D-Iran (0.038%) 2 , while in the second study , HPLC records on 800 patients were analyzed in which Hb D Iran was one of the rarest Hb variant reported 3 . Its only implication is in its diagnostic difficulty if the screening method employed is CE-HPLC (Cation exchange- High performance liquid chromatography). Hb D Iran co-elutes in A2 window of chromatogram yielding raised A2 percentage and is often misdiagnosed as Hb E. Similarly, in CZE (Capillary zone electrophoresis) a peak in D zone is often wrongly diagnosed as Hb D Punjab, which is a more prevalent in Pakistan. The need for correct diagnosis is mandatory in cases of compound heterozygous state of β/Hb D Iran. These cases exist as an asymptomatic or in a mild clinical state. They can be wrongly interpreted as homozygous for Hb E or compound heterozygous for β/Hb E. The latter can be mildly symptomatic or manifest as transfusion dependent state. Such cases require intensive workup and PND (prenatal diagnosis) which may otherwise be unnecessary if correctly diagnosed as β/Hb D Iran. Therefore in laboratories utilizing CE- HPLC instruments only, β/Hb D Iran compound heterozygotes are falsely reported as either homozygous Hb E 4 or compound heterozygous for β / Hb E. This is because the elevated Hb A2 peak is misinterpreted. Hence the need for two methods of detection of Hb variant cannot be stressed upon enough. ----------------------------------------------------------------------------------------- Received on 24-05-2021 Accepted on 14-10-2021 Therefore we aimed to study all cases eluting more than eight percent in the A2 window on CE-HPLC and those yielding peaks in D zone on CZE and also to determine the frequency of Hb D-Iran existing in heterozygous, homozygous and compound heterozygous state in the subjects under study. MATERIAL AND METHODS The study was conducted at Punjab Thalassemia Prevention Project regional labs from October 2019 – March 2021 after permission from IRB. Samples were collected as part of extended family screening of thalassemia major children in Punjab. Written consent was obtained from subjects for hemoglobinopathy screening (CBC and HPLC/CZE) and genetic analysis. Venous blood samples collected in K3 EDTA (ethylene diamine tetra acetic acid) evacuated tube were analyzed for routine complete blood count by Sysmex XP-100. Samples of patients with thalassemic red blood cell indices and their parents were marked for hemoglobinopathy screening. Two methods are employed in our set up; Cation Exchange- High Performance Liquid Chromatography on the Bio-Rad Variant II β-thalassemia short program and Capillary Zone Electrophoresis based on migration of different Hb variants using Sebia Capillary’s 2 Flex piercing instrument. Results were analyzed using SPSS version 20. Samples subjected to CE- HPLC initially, yielding Hb A2 of more than eight percent were taken into account. These were 126 samples which were then analyzed using CZE as a second method to confirm presence of the variant. Those showing migration pattern in D zone were suspected as cases of Hb D Iran and confirmed by ARMS-PCR (Amplification Refractory Mutation System- Polymerase Chain Reaction) T 100 Bio Rad thermal cycler. Molecular characterization was done using forward primer (CAACCTGCCCAGGGCCTCACCACCAACATG) and reverse primer (ACCTCACCCTGTGGAGCCA). Primary denaturation was done at 94-95°C for five minutes, followed by 25-35 cycles of denaturation at 94°C for one minute, 30sec at 55° C for annealing, one minute at 72°C for extension and with a final extension at 72°C for 5 min. The PCR product of 255 bp was electrophoresed by 2.0% agarose gel electrophoresis followed by ethidium bromide staining and visualized by Bio Rad Gel Documentation system.